1kx4 image
Deposition Date 2002-01-31
Release Date 2002-12-25
Last Version Date 2023-08-16
Entry Detail
PDB ID:
1KX4
Title:
X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Biological Source:
Source Organism:
Homo sapiens (Taxon ID: 9606)
Xenopus laevis (Taxon ID: 8355)
Host Organism:
Method Details:
Experimental Method:
Resolution:
2.60 Å
R-Value Free:
0.3
R-Value Work:
0.24
R-Value Observed:
0.24
Space Group:
P 21 21 21
Macromolecular Entities
Structures with similar UniProt ID
Protein Blast
Polymer Type:polypeptide(L)
Molecule:histone H3
Chain IDs:C (auth: A), G (auth: E)
Chain Length:135
Number of Molecules:2
Biological Source:Xenopus laevis
Structures with similar UniProt ID
Protein Blast
Polymer Type:polypeptide(L)
Molecule:histone H4
Chain IDs:D (auth: B), H (auth: F)
Chain Length:102
Number of Molecules:2
Biological Source:Xenopus laevis
Structures with similar UniProt ID
Protein Blast
Polymer Type:polypeptide(L)
Molecule:histone H2A.1
Chain IDs:E (auth: C), I (auth: G)
Chain Length:128
Number of Molecules:2
Biological Source:Xenopus laevis
Structures with similar UniProt ID
Protein Blast
Polymer Type:polypeptide(L)
Molecule:histone H2B.2
Chain IDs:F (auth: D), J (auth: H)
Chain Length:125
Number of Molecules:2
Biological Source:Xenopus laevis
Polymer Type:polydeoxyribonucleotide
Molecule:DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3')
Chain IDs:A (auth: I), B (auth: J)
Chain Length:146
Number of Molecules:2
Biological Source:Homo sapiens
Primary Citation
Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol. 319 1097 1113 (2002)
PMID: 12079350 DOI: 10.1016/S0022-2836(02)00386-8

Abstact

Solvent binding in the nucleosome core particle containing a 147 base pair, defined-sequence DNA is characterized from the X-ray crystal structure at 1.9 A resolution. A single-base-pair increase in DNA length over that used previously results in substantially improved clarity of the electron density and accuracy for the histone protein and DNA atomic coordinates. The reduced disorder has allowed for the first time extensive modeling of water molecules and ions. Over 3000 water molecules and 18 ions have been identified. Water molecules acting as hydrogen-bond bridges between protein and DNA are approximately equal in number to the direct hydrogen bonds between these components. Bridging water molecules have a dual role in promoting histone-DNA association not only by providing further stability to direct protein-DNA interactions, but also by enabling formation of many additional interactions between more distantly related elements. Water molecules residing in the minor groove play an important role in facilitating insertion of arginine side-chains. Water structure at the interface of the histones and DNA provides a means of accommodating intrinsic DNA conformational variation, thus limiting the sequence dependency of nucleosome positioning while enhancing mobility. Monovalent anions are bound near the N termini of histone alpha-helices that are not occluded by DNA phosphate groups. Their location in proximity to the DNA phosphodiester backbone suggests that they damp the electrostatic interaction between the histone proteins and the DNA. Divalent cations are bound at specific sites in the nucleosome core particle and contribute to histone-histone and histone-DNA interparticle interactions. These interactions may be relevant to nucleosome association in arrays.

Legend

Protein

Chemical

Disease

Primary Citation of related structures