1JUA image
Deposition Date 2001-08-24
Release Date 2004-01-20
Last Version Date 2024-05-22
Entry Detail
PDB ID:
1JUA
Keywords:
Title:
Solution Structure of the Deoxyribose HIV-1Lai Initiation Sequence Stable Dimer
Biological Source:
Source Organism:
(Taxon ID: ) (Taxon ID: )
Method Details:
Experimental Method:
Conformers Calculated:
13
Conformers Submitted:
13
Selection Criteria:
back calculated data agree with experimental NOESY spectrum, structures with acceptable covalent geometry, structures with the least restraint violations, structures with the lowest energy
Macromolecular Entities
Polymer Type:polydeoxyribonucleotide
Molecule:5'-D(*CP*TP*TP*GP*CP*TP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP*CP*AP*AP*G)-3'
Chain IDs:A, B
Chain Length:23
Number of Molecules:2
Biological Source:
Ligand Molecules
Primary Citation
A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.
J.Biomol.Struct.Dyn. 19 649 658 (2002)
PMID: 11843626

Abstact

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

Legend

Protein

Chemical

Disease

Primary Citation of related structures